Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13517A10
Clone ID IST13517A10
Vector VICTR74
Project tigm

Sequence tag IST13517A10HMR1
Sequence
TTCCTTTTGTATGCAGAAGGGAACCGTGGTGTGGAGAGGTGTGTACTGTCCCCAGGGTCATTGCTGTAGGAGCGATC
Sequence Type genomic DNA
Unitrap ID UNI2830

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 66546707..66546783 77
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019873 (Reep3) NM_178606 receptor accessory protein 3 Gene [Source:MGI Symbol;Acc:MGI:88930]


Sequence tag IST13517A10HMF1
Sequence
GGAATACCACACACCAGGGGGTTCCTCTCCATTTCANAGGATCTCTTCACCTGATAGTTCAGAGCCATCCAGGGCCCAAG
GCTAAAGCTTCCACTTCTAACCCTGAGGCACTGCTCTAAAACAGATGTGTGAGGTGAGCTCTTTCCTTCTCCCCTCCCCC
TTCCTCCCCTTGTCTTTTCCTTGTCTTGCANANACAGGGACTGAACCCAGGACTTCATGCATGCAAGGGAANTCTTAACA
CTGANACATATCTCTAACTCAAATTAAAGTACTTTTATGGAAGCACTGGGTAGTCTCAAGTAATGTAAGGCTTTGGACTA
NTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 66546780..66547102 311
 
EST/CDNA Est Name
  BB851566.1 - AA015359.1 - BB848313.1 - AI152361.1 - AI322473.1 - CJ184231.1 - CJ173756.1 - CJ175785.1 - CJ178367.1 - CJ163296.1 - CJ163871.1 - CJ176158.1 - BY168997.1 - BY179427.1 - BF470037.1 - CJ175652.1 - CJ171218.1 - CJ171336.1 - CJ172146.1 - CJ170013

 
Come back to gene BB851566.1 - AA015359.1 - BB848313.1 - AI152361.1 - AI322473.1 - CJ184231.1 - CJ173756.1 - CJ175785.1 - CJ178367.1 - CJ163296.1 - CJ163871.1 - CJ176158.1 - BY168997.1 - BY179427.1 - BF470037.1 - CJ175652.1 - CJ171218.1 - CJ171336.1 - CJ172146.1 - CJ170013


For any suggestions or comments, please send an email to unitrap@crg.es