Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14100C10
Clone ID IST14100C10
Vector VICTR74
Project tigm

Sequence tag IST14100C10HMF1
Sequence
GACTTGTAACTCTTTAGCAGTGTTTTCCTGTTTTTCTTTAAGGACTTGTAACTCTTTAGCAGTGTTCTCCTGTATTTCTT
TAAGTGAGTTGTTGAATTCCTTCTTTATGTCCTCTACCATCATCATGAGATATGCTTTTAAATCCAGGTCTACCTTTTCA
GGTGTGTTAGGGTGTCCTGGNTTGGGCNANNNGNNCNTN
Sequence Type genomic DNA
Unitrap ID UNI31402 UNI32049 UNI32050

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 16942571..16942757 185
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 16496641..16496827 185
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 24710889..24711075 185
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 16421101..16421287 185
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 5176134..5176320 185
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 36018246..36018432 185
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041078 (Grid1) NM_008166 glutamate receptor, ionotropic, delta 1 Gene [Source:MGI Symbol;Acc:MGI:95812]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 34873182..34873368 185
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 81643180..81643366 185
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 23952320..23952506 185
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024277 (Mapre2) NM_153058 microtubule-associated protein, RP/EB family, member 2 Gene [Source:MGI (curated);Acc:Mapre2-006]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 11296995..11297181 185
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 50625166..50625352 185
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 17633275..17633461 185
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 20430684..20430870 185
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 56234020..56234206 185
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 35294968..35295154 185
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 37827430..37827616 185
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 84483939..84484125 185
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037940 (Inpp4b) NM_001024617 inositol polyphosphate-4-phosphatase, type II Gene [Source:MGI Symbol;Acc:MGI:2158925]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 93811335..93811521 185
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_161872: 626205..626391 185
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_161897: 841805..841991 185
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_165795: 83653..83839 185
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_165798: 84755..84941 185
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166383: 124882..125068 185
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166420: 27079..27265 185
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 20837254..20837440 185
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr Y: 1108326..1108512 185
NO GENE  

 
Come back to gene ENSMUSG00000037940


For any suggestions or comments, please send an email to unitrap@crg.es