Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone A006E01
Clone ID A006E01
Vector pT1ATGbetageo
Project ggtc

Sequence tag A006E01
Sequence
GACCGGCCTCGCTTTCTGGGGCTAGTAGAGCCCCTTCCTTCCGAGCCTTTCGGTTCCACCCCTTCCGCGGGAACTTTGTG
CTTCCGGCAAGCTTGTCCGGAGCTGGGACCCTCTAGCGCAGCTGAGTTGATGACTGCTGGAGGGACCACTGGTAGAGCCG
AAGAATATGAATAGTTTCTCAAGAAAAGTACATTACTTTTGGCACAAGAAGCAGAATAACTGTGAATTGTTATCACGTGG
AATTTTTCAGTAAAAATCACTGAAAATTTTTTCATTACACGCAA
Sequence Type mRNA
Unitrap ID UNI11471

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 74546530..74552354 147
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033364 (Usp37) NM_176972 ubiquitin specific peptidase 37 Gene [Source:MGI Symbol;Acc:MGI:2442483]

 
Come back to gene ENSMUSG00000033364


For any suggestions or comments, please send an email to unitrap@crg.es