Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14995G6
Clone ID IST14995G6
Vector VICTR78
Project tigm

Sequence tag IST14995G6HMR1
Sequence
CATCTATTCTNATNNGACAAGAAGGGAACGGGGAAAGTAAAGGAAGATTCTGTCTAGACCAGCTCGGCGAAGTAAACCAA
TTTATTAAACCAAAAGCCGAAACCCTTACGCATCACATCAGCAAGAGATTCTAGAGTATGGTGACAAAGGAAACTGATGT
GGATATCGTATATAGAGATTGGTGACACTGTGGCAGAATAAGACTCTGTATCAGGGGCTGGTGAGATGGCTCAGTGGGTA
AGAGCACCCGAGTGTTCTTCTGAAGGTCCAGAGTTCAAATCCCANCAACCACATGGTGGCTNACAACCATCCGTAACAAG
ATCTGACTCCCTCTTCTGGAGTGTCTGAAGACAGCTACAGTGTATTTACATATAATAATAAATAAATCTTAAAAAAAAAA
N
Sequence Type genomic DNA
Unitrap ID UNI22123

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 110715723..110716122 390
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000007080 (Pole) NM_011132 polymerase (DNA directed), epsilon Gene [Source:MGI (curated);Acc:Pole-001]

 
Come back to gene ENSMUSG00000007080


For any suggestions or comments, please send an email to unitrap@crg.es