Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P070G07
Clone ID P070G07
Vector FlipROSACeoC+2
Project ggtc

Sequence tag P070G07
Sequence
TGGGCAAGAAGGCACGGAAATCTTTACAAGAAACCATCCAGTCCTTGAAGGTTACCAACCAGGAGCTTCTGAAGAAGGGC
AGTGGTGGCAGTGAGCATGTTCTCACCTGTGACACAGCCTGCAAGGGCTTGTTGCAACGGGCACGGGGTCCTCGGCCACC
CTGGGCCCGGCTATTCCTGGGGCGTCTGGTCTTTGCAGTAGGATTCCTATGTCATGAC
Sequence Type mRNA
Unitrap ID UNI11476

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 31176908..31177316 117
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038828 (1110039B18Rik) NM_144525 transmembrane protein 214 Gene [Source:MGI Symbol;Acc:MGI:1916046]

 
Come back to gene ENSMUSG00000038828


For any suggestions or comments, please send an email to unitrap@crg.es