Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14562E11
Clone ID IST14562E11
Vector VICTR74
Project tigm

Sequence tag IST14562E11HMR1
Sequence
CTCATCACCACCTCTCAGCAATACANTNNNNAGATGAATCCATCAGGAGATTCATACATTGATTAGGTCAGAGCCCTCAG
AATCCAGACACTTCTGAAAATCTGTCAGCAGACAACCAAGCCCCTAATACTTTAGACTGGGATGGGAGGGGAGATGAGGC
ATTACATACTCAAACTACNGTGCATTTTCATGCTGGGGTATGTATATATAACTCTCTTCCCCCACAAACCCTATCTTGCC
TATAGCTCTCATTTGCTTTTGTCACTTAACAAAACACCACAGACNTCTGCTTTATGATTACCTTNATTCNAAACACAGTT
CAGGCTGGAGTTGGCTCAATGGTTCCGAGCGAGCGCTTGCTGCTCTTCCAGTAGACATGACTTTGGTTCCTAGCACTCAC
ATCANGCAGCTCACTGCAGTCNGNAACTGCAGTTCCNAGGGATACAATGTTCTCTTCTAGCCTTTGTGGGCNCCTGCATA
NAACTGCATGTANNATACACACN
Sequence Type genomic DNA
Unitrap ID UNI26736

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 84657540..84658041 468
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028086 (Fbxw7) NM_080428 F-box and WD-40 domain protein 7 Gene [Source:MGI (curated);Acc:Fbxw7-001]


Sequence tag IST14562E11HMF1
Sequence
TTANGAGGCGGGTCTACTGGAATAAATCAATCACTGGAGTGTGAACCTGGGGCTATCACTTGCCCTTGCCCCACTGGATC
TCCTTCTATGTCCTTCCAAGGCTGTTGTGATGTTCATGCTTTGCTGTGCTATACCCTCCTCATCATAATCAACACAAGTC
TCTAAAATCAGGAGCTGAAATAAAGTGTANTCNTATACATACATACATGCACACACATGTACACATATACTTACACACAC
ACATACAGAGAGATGTGTTCCTTACTTGCTTTTCTCAAGAACTGTTCNCTANGATGTAAAAAGCCTGAGTANTANCAATA
CTAGAACAGCTCTGCCTCTGCNAACTCAANTCTTCTGGAGANAGCATGTAATTGTATTAACCACTTGTCTCGTCCTCGCC
CTGACAAAACACCTGANANAANCTACNCNAGGAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 84657107..84657539 399
 
EST/CDNA Est Name
  BX523157.1 - AW908676.1 - AW908687.1

 
Come back to gene BX523157.1 - AW908676.1 - AW908687.1


For any suggestions or comments, please send an email to unitrap@crg.es