Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P070B12
Clone ID P070B12
Vector FlipROSACeoC+2
Project ggtc

Sequence tag P070B12
Sequence
GGGGTGTGCATAATACCTCAGTGGCGGACTTCAGAAAGCCCTGGGAGAGGAAAGCATCCACTCAGAGCAGAGCTCAGGG
Sequence Type mRNA
Unitrap ID UNI10538

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 45874465..45878538 46
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000011256 (Adam19) NM_009616 a disintegrin and metallopeptidase domain 19 (meltrin beta) Gene [Source:MGI (curated);Acc:Adam19-001]

 
Come back to gene ENSMUSG00000011256


For any suggestions or comments, please send an email to unitrap@crg.es