Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone M090F01
Clone ID M090F01
Vector FlipROSACeoC+2
Project ggtc

Sequence tag M090F01
Sequence
GGGGGCAGTACACGTGATCAAACTTGAACGTAAGTGTGAGTGTGTGTATTTAGTGGGCTTTTGGTATAAAGCACATGGGC
AAGGTTGTGGTTGGGTTGTGACTGAGGTCTCTTCACTCTGGAAATACATTGGACCTTTCCTGCGTGGGATCCGGAATGTA
CCTCAAGAGGAAGCCAATAAGGTAGCCCTCCGCTACAGCATGAACTCATAATACCTCAGTGGCGGACTTCAGAAAAGCCC
TGGGAGAGGAAAGCATTCCACTCAGGGCAGAAG
Sequence Type mRNA
Unitrap ID UNI10523

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 45874422..45874510 82
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000011256 (Adam19) NM_009616 a disintegrin and metallopeptidase domain 19 (meltrin beta) Gene [Source:MGI (curated);Acc:Adam19-001]

 
Come back to gene ENSMUSG00000011256


For any suggestions or comments, please send an email to unitrap@crg.es