Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15057G7
Clone ID IST15057G7
Vector VICTR80
Project tigm

Sequence tag IST15057G7HMF2
Sequence
ATATCTGCATCTACATGCGCACACACATGCATGTAGCGCTTCATGAATCTCAAACTGCCTATAAGCTGGCTATGTAGCTG
AGGCTGGGCAAGATCCTCCTGCCTTTACCTCCTGGCGTACTAGTATTATGTGGAAAGTTTGAGCCACCACACCAACCTTC
GTAATTTTTAATTCAGAGATCCCCTAAGCACCTTTAGGTCTATGTTTGACGGTTGCTATGGATAATTCTTGATGACACAT
GGAGTGGTTAGTGTTTTGCTGGCCCCCTTAAGAACAAGTGATAATAAGCAGCAAGGACCTCTAGAATGCTCCTTTACTCT
TGGTTTTTTGAGACAGGGTTTCTGTCAGTCACTGCCTGGCTCCTTTATTCTTGCTGGGCATCTAATATCACTTTTCTTTC
CCCATACCATTGCTAGCCCCAGTGTTCACATAATCTGTAACTCCCGACTANGTGGANAAATGGAACCGACGTGATCNGAA
GCTGCTGGAGNCGGTGCANCGGGGGGACGTGGNNNNCGTGGCTGCCNNGNCT
Sequence Type genomic DNA
Unitrap ID UNI22153

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 96481605..96482130 508
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038354 (Ankrd35) NM_001081139 ankyrin repeat domain 35 Gene [Source:MGI (curated);Acc:Ankrd35-001]


Sequence tag IST15057G7BBF1
Sequence
CCCACACGCTATCAACCGCTGTCCACAGGAGGGGAGGATCATTGCTTCTCTGGACTTAGCCCAAGAGAAGAGACACGTTC
CCTAGCGACTCTCCTCACCACGCAGCCAGCGCTCGGGGCTTCACCTGTCCTCAGTTTTCCCCAGGTCTCTGGCCTACCAC
CCATGGCCTGTGGGGCTGGAAAGTTCACGAAAGCCCAGAAAGCTCTTCGAGGTGGCAATCTGGCCCTACACTCTCCTGAA
TCCCTTCGTTATCGGGACTCCTGACCCTTGTCCTTCCCATAAGGAAAGCACTTAGCGTCTGGCTTGTGCCTGGGAGGGGA
ACTTTTGCGTTTGTAGGGTTCCGACGGAGGTCAGGGCCAAAGGGAGTCCGGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 134035389..134035763 375
 
EST/CDNA Est Name
  AI845302.1 - BY705206.1 - BY194838.1 - BY209675.1 - AI844192.1 - BY176969.1


Sequence tag IST15057G7HMR1
Sequence
GAATTCTGGTGTTTGTCCTTTATTTACTGTGAAGAACGTGTGCCATGTGTTCTGTATTAAGACCGAAAGCAGCCATTACT
GAGCCTGTTGCTATTTTGACCACTTAAGGCAGCTCGCTGTTCCGGCTGGGATTTCCAACCCTTACCCAGTGAAGTGCAAA
AGAATGAAACAGACTCCTCGGAGAACCTGACACGTGCATCATCCACATGTTTTCCAGACTGGAAGTAATTTATGCTCAGG
AAAGTTGCCTAATGAATCTTTTTTTAATTTTAATATTTACATGATTTATGTTGGAATTGAAAATAACAATGAAATAATAT
TTGATCTAAACTCCATGCTGTACTTACATGGTGACNTGTGCATGCNCGCGCGCGCGCNCNNNNNNNTATGTGTGTGTGTG
TGTGTGTGTGTNTNTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 102912820..102913230 391
 
EST/CDNA Est Name
  BY121351.1 - BY120071.1

 
Come back to gene BY121351.1 - BY120071.1


For any suggestions or comments, please send an email to unitrap@crg.es