Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13048H9
Clone ID IST13048H9
Vector VICTR76
Project tigm

Sequence tag IST13048H9HMR1
Sequence
CAAGGAGGGCCCAGCTGAAGGCTGACAGTCTGCTCCAAGATTAGCCCCCTGCTTCCTCACCGGAAGGAGGGAGTTTGAGC
CAGTCGGAAGCCGGGATGCC
Sequence Type genomic DNA
Unitrap ID UNI14138

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 72960599..72960698 100
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005947 (Itgae) NM_008399 integrin alpha E, epithelial-associated Gene [Source:MGI (curated);Acc:Itgae-001]

 
Come back to gene ENSMUSG00000005947


For any suggestions or comments, please send an email to unitrap@crg.es