Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14111H10
Clone ID IST14111H10
Vector VICTR74
Project tigm

Sequence tag IST14111H10HMR1
Sequence
ACTTTTTGTGTGTTTAAATTGAGGCATTTGAAGACTGTTTAGATTCTGATCTTTGGCTCTGGGTGCAATAAATACGCATT
AAAGCCAAAGTANAAATTGTTC
Sequence Type genomic DNA
Unitrap ID UNI30317

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 22146546..22146646 99
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033581 (Igf2bp2) NP_898850 insulin-like growth factor 2 mRNA binding protein 2 Gene [Source:MGI (curated);Acc:Igf2bp2-001]


Sequence tag IST14111H10HMF1
Sequence
CAACCCTAACCAGAACACTTTCAAACCTATTTAAACACCCTGCTTTTCATTAACATATTTCTTTACTGGTCTATTTTACT
TTCAAACCCATCTGCCTTTTCAAGGAGTGGGGANCACAACTGTTACCCCAGCACACAGGAAAGCAGGGGCGGGGTAATTA
CACATCTCAGGCCAGTCATTCTAAGAAAAAAATTAAAACGTTCTACGTCGCCTTATAGTANACATTTACCTGAAACATAT
TTTCAGAAGTGTTTATCTGAGCTAGCAAGATGGCTCAATGGTTATAGCAGCTACTTTTCTGCTGCTGTGCTAAAACACCA
TGACCAAAAGCAAGTTAAAGAANGGCTTATCTTGGTTTGTAGTTCCAGGGGGTTAAGAATCCNTCACGGTGGGGACACAT
GGAAGTNNGTGGCANGCNNGTGGGACACATGGAAGTNNGTGACAGGCNTTGCANTGGGGACNNGGTGCTNANCTCTCGCA
CCCTNAGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 22146649..22147135 451
 
EST/CDNA Est Name
  CO434597.1 - CB247330.1 - BB643209.1 - CF736105.1 - BU705477.1 - BY720350.1 - CJ199139.1 - BY734118.1 - BB618315.1 - BY728768.1 - BY740124.1 - CJ092638.1 - CJ092838.1 - BU152527.1 - BY739897.1 - DV658559.1 - BY739218.1 - BQ770242.1 - BY754054.1 - CJ169368


Sequence tag IST14111H10BBF1
Sequence
NNNNNNNNNNNNNNCACTTTCNAACNNANTTAAACNCCCTGCTTTTCATTAACATATTTNNTTANNGGTCTATTTTACTT
TNNAACCCATCTGCCNTTTNAAGGANTGGGGANCNCAACTGTTACCCCAGCACACAGGAAAGCAGGGGCGGGGTAATTAC
ACATCTCANGCCNGTCATTCTAANAAAAAAATTAAAACGTTCTACGTCGCCTTATAGTANACATTTACCTGAAACNNANN
NNNNNAAGTGTTTATCTGAGCTAGCAAGATGGCTCAATGGTTATAGCAGCTACTTTTCTGCTGCTGTGCTAAAACACCAT
GANNNNNAGCNAGTTAAAGAANGGCTTATCTTGGTTTGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene CO434597.1 - CB247330.1 - BB643209.1 - CF736105.1 - BU705477.1 - BY720350.1 - CJ199139.1 - BY734118.1 - BB618315.1 - BY728768.1 - BY740124.1 - CJ092638.1 - CJ092838.1 - BU152527.1 - BY739897.1 - DV658559.1 - BY739218.1 - BQ770242.1 - BY754054.1 - CJ169368


For any suggestions or comments, please send an email to unitrap@crg.es