Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14417G1
Clone ID IST14417G1
Vector VICTR74
Project tigm

Sequence tag IST14417G1HMR1
Sequence
ANGTGTACACCTTAGTTTGAATAATCTCTTCTGAAAACNNCGGTTGCTTTTTCTCCTGCTTTCTGGACTGTAAGTCTGCC
AATCTCCCCTTTGCTATCCAAAAGTTTGGTTGGCATGTGTGTGCCCGAAGAACTGTGAGCATGACTAGTATGCACAACAA
AGCTTTTCTTTTTGAAACTTTAAGCATGCTGAAGTTATGCAGAAACGGAGAGAGAGTTGCANCCNNTGTCC
Sequence Type genomic DNA
Unitrap ID UNI433

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 160513223..160513450 218
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040749 (Siah1b) NM_009173 seven in absentia 1B Gene [Source:MGI (curated);Acc:Siah1b-002]


Sequence tag IST14417G1BBF1
Sequence
CATTCAAATTATTTCTCAAGCTTTTTCAGGAAAAGACAAACGAGGTGGAGTTATACTTACAAGTTTCCAGCAGCTTCAGT
CCAGTAGCCAGCCCTTAATGCCTGCTGTCATCCGGATCCCANGCNNNNNTTTGAANTTCCTGGTCNCTCNATNTGNANTA
GGGCACAAAAGAAAAAAAAAAAAAAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000040749


For any suggestions or comments, please send an email to unitrap@crg.es