Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14882D7
Clone ID IST14882D7
Vector VICTR76
Project tigm

Sequence tag IST14882D7HMR1
Sequence
TGTCTGCCTGTCTAGGCAGCGGACAGTCCTGGGTGTCTTTCCTTAGGAATCATCGATCCCATTTGTATAAGATGTGTTCC
TCACTGATGTGACTTCACTGATATGACGCTCCTTGAGTGTAGGCTAANCTGGCTGGCCN
Sequence Type genomic DNA
Unitrap ID UNI17114

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 123413794..123413931 136
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029475 (Fbxl10) NM_001003953 F-box and leucine-rich repeat protein 10 Gene [Source:MGI (curated);Acc:Fbxl10-003]


Sequence tag IST14882D7BBF1
Sequence
ACATCATGCACACACGCATGCTGCACGTGTACACGAAGGCTCATTTCTGGGGCTAGGGATTTGGATCAATTGGTACAGTG
CTTGCCTAACACTTGCAATGTGCCAGTCTCCATCCCAAGCATTGCAGAAACCATGAAGGCCCTGTATACCTATATCCAAA
ACCCAGAAGTCTGAGTGAGGCAGGAGGATTACCACCATGGGTTCAAGGCCANCATGGGCTAAATNNTGAGCTATANCCNA
GTCTANACCACATTGTGGGACCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 123413929..123414190 248
 
EST/CDNA Est Name
  AV086717.1 - BY013291.1

 
Come back to gene AV086717.1 - BY013291.1


For any suggestions or comments, please send an email to unitrap@crg.es