Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone M110E04
Clone ID M110E04
Vector FlipROSACeoC-2
Project ggtc

Sequence tag M110E04
Sequence
TTTCCTNNCCCCCAAGGATTTTCCTGATGNNNNTNTTCAGNNNGATNCGTGAGAGACACAACATCTGTAAGCAGATCCAC
CTGCCAGCCCAGAGTGGAAGCAGCCGTGTACTGGATGCCATGCGGAGAGGATATTCAAGAGAAGCATATGTGGCATTAGT
TCATCATGTCAGAGAGACTATCCCAGGTGTGAGCCTTAGCAGCGACTTCATCACTGGCTTTTGTGGAGAGACAGAGGATG
ATCACCGGCAGACAGTGTCTTTACTTAGAGAAGTGCAGTATAATACCGGTTTTCTCTTTGCATACAGCATGAGGCAAAAG
ACACGAGCATATCACAGGCTGAAGGATGATGTTCCAGAAGAAGTAAAATTAAGGCGTTTGGAGGAACTCATTACTGTCTT
CAGAGAAGAAGCTTCAAAAGCCAATAAGACCTCAGTGGGTTGTAGCCAGCTGGTACTGGTTGAAGGGTTCAGCAAACGTT
CTACCACAGACCTTTGTGGCCGGAATGATGCAATACCTTACGGTGATTTTACTTATCGCAGAGGTGGAGGATATCATCTA
CCCCTGGGCTCAAGGTCAGAGCTCAACCTGGGGAATATGTGCTGCGAAG
Sequence Type mRNA
Unitrap ID UNI11485

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 154168043..154178947 151
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027487 (Cdk5rap1) NM_025876 CDK5 regulatory subunit associated protein 1 Gene [Source:MGI (curated);Acc:Cdk5rap1-001]

 
Come back to gene ENSMUSG00000027487


For any suggestions or comments, please send an email to unitrap@crg.es