Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CC0215
Clone ID CC0215
Vector pGT0lxfT2
Project sanger

Sequence tag CC0215
Sequence
CTCAAACAGCTGGGTGTCGAGATATTTGAAACTGCAGAGTGTGAGGAGGGAAATGGTGAATCACAGGACCGACCCAAACT
GGAGCCTTTTTATGTCGAACGGTATTCTTGGAGTCAGCTGAAAAAGCTGCTTGCTGATACCAGAAAATACCACGGCTACA
TGATGGCTAAGGCGCCACATGACTTTATGTTTGTAAAGAGGACGGATCCAGATGGGCCTCACTCAGACAGGGTCTATTAC
CTTGCCATGTCTGGTGAGAACAGAGAAAATACACTATTTTATTCTGAAATCCCTAAAACCATCAACAGAGCAGCAGTCTT
AATGCTTTCCTGGAAGCCCCTTTTGGATCTTTTTCAG
Sequence Type mRNA
Unitrap ID UNI1554

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 64884809..64890183 241
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032393 (Dpp8) NM_028906 dipeptidylpeptidase 8 Gene [Source:MGI Symbol;Acc:MGI:1921638]

 
Come back to gene ENSMUSG00000032393


For any suggestions or comments, please send an email to unitrap@crg.es