Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12335G9
Clone ID IST12335G9
Vector VICTR76
Project tigm

Sequence tag IST12335G9HMF1
Sequence
AAGACGAGATACATGAACTCTGCCTTGGGCCAGTACCACAGCGCAGGTCACTGTGCCCTTACCATGCTCCGGAAGGAGGG
ACCCCGCGCCTTCTACAAGGGGTGAGCCTCAGATCCCCTCACAGAACTCCAGAGAAGTGAGATGCAGCCAAATGTCAGAC
AGCCCATAGTTGCTGTCACCTCTGTTTTTTAGAAGTTAAAATGAGCATTCAGACTGGGGGTTGGGGATGGGTGGGTCAGT
GGTGGAGGGCTTGCTTAGCATGCTTGGAGACCCTGGGTTCTGCTCCCCAGCACAGCAGGAGTANGGAGCTGGGTACTCGG
GATTCTTGGGCATGTGGA
Sequence Type genomic DNA
Unitrap ID UNI32057

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 107647325..107647661 335
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033685 (Ucp2) NM_011671 uncoupling protein 2 (mitochondrial, proton carrier) Gene [Source:MGI (curated);Acc:Ucp2-001]


Sequence tag IST12335G9BBF1
Sequence
AAGACGAGNTACATGAACTCTGCCTTGGGCCANTACCACAGCGCANGTCACTGTGCCCTTACCATGCNNNNGAAGGAGGG
ACCCCGCGCCTTCTACNNGGGGTGAGCCTCANATCCCCTCACAGAACTCCANANAAGTGAGATGCANCCNAATGTCAGAC
AGCCNATAGTTGCTGTCACCTCTGTTTTTTANAANTTAAAATGANCATTCNNACTGGGGGTTGGGGATGGGTGGGTCNNT
GGTGGAGGGCTTGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000033685


For any suggestions or comments, please send an email to unitrap@crg.es