Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CC0205
Clone ID CC0205
Vector pGT0lxfT2
Project sanger

Sequence tag CC0205
Sequence
CGTTTTCCTGATTTCTCTACCCCTTGTTCTATTCCGTCTCCTTTCCGATCTTACTATGTCTTTACCTTTTTTATCACTCT
CGTCATTTTTCTAATGTTCATTCTCTCTGATGACCACTATTTGGCCTGTGTTCTTGGCCCCCTTATCTTGGATTAGACCT
TAACTCTCGGTTCTTCTTCTGTTTCTCTGTTCTACGGTTTCTGTTTTTCCCTCTCGGTCCCAGCCTCCTCGCCGCAACCC
CCGCCGTAGCTGCCGCTGCTCCCGCCGTCACCGCCTCCGAG
Sequence Type mRNA
Unitrap ID UNI1557

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 52174588..52174654 65
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020402 (Vdac1) NM_011694 voltage-dependent anion channel 1 Gene [Source:MGI (curated);Acc:Vdac1-001]

 
Come back to gene ENSMUSG00000020402


For any suggestions or comments, please send an email to unitrap@crg.es