Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13054G9
Clone ID IST13054G9
Vector VICTR76
Project tigm

Sequence tag IST13054G9HMR1
Sequence
GGTAATTGATTTCTAAGTGAAATTACTCTTAACAAAATAACCAGAGGTAGAGTATGATATCCCAGACTCTACNCGCACTT
AAATACNNNNNNCTGTCAAGCATTAANTTTGAGAGGCAAGTATAGTTAGGAGAACTTTGAGAACCATAGGGAACTAGAAA
CTCCTAGTGCTATCTTANCACAAATACTCTATAAGACACCTTAATTGTANCTCTTGATCTCCCTCANCCATATATCCCTT
GGTTTGGTGTCCCANAAGCAGTGTTGGAAGGTTCCCCTCACATTTGAGATCCTGTAGCAGTGTGGCCN
Sequence Type genomic DNA
Unitrap ID UNI32067

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 12430281..12430587 283
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000014426 (Map3k4) NM_011948 mitogen-activated protein kinase kinase kinase 4 Gene [Source:MGI Symbol;Acc:MGI:1346875]

 
Come back to gene ENSMUSG00000014426


For any suggestions or comments, please send an email to unitrap@crg.es