Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15078E7
Clone ID IST15078E7
Vector VICTR80
Project tigm

Sequence tag IST15078E7HMF1
Sequence
CCTATTACTTGTGTAATCTTTGTTTATTTAGCCTTTCCAATATACAGAGATCTTCCTGGTTTTCTACAATATTTAAGAGT
ATGTCTAGCTAGCTAGGAAAGAATCCTTCTTGTGTCTTCCCCATTTCTCTCTGCAGTTTCCTTGTTCATTTGTTGTTGTT
GTTGCTGCTGCTGTTGTTATTGTTACTGTTGTTGTTGCTGCTGTTATTGTTGCTGTTGCTACTACTGTTGCTGCTGCTGT
TGTTGTTGCTGTTGCTGCTGCTGTTGCTGCTGTTGTTGCTGNTGCTGCTGTTGTTGCTGCTGTTGTTGCTGNTGCTGCTG
TTGTTGCNGCTGTTGATGCTGCTGCTGCTGCTGCNGCTGN
Sequence Type genomic DNA
Unitrap ID UNI19842

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 137542701..137543059 351
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074212 (Dnajb14) DnaJ (Hsp40) homolog, subfamily B, member 14 Gene [Source:MGI (curated);Acc:Dnajb14-001]


Sequence tag IST15078E7BBF1
Sequence
CCTATTACTTGTGTAATCTTTGTTTATTTAGCCTTTCCAATATACAGAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI19842

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 137542701..137542753 53
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074212 (Dnajb14) DnaJ (Hsp40) homolog, subfamily B, member 14 Gene [Source:MGI (curated);Acc:Dnajb14-001]

 
Come back to gene ENSMUSG00000074212


For any suggestions or comments, please send an email to unitrap@crg.es