Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12266C1
Clone ID IST12266C1
Vector VICTR76
Project tigm

Sequence tag IST12266C1HMF2
Sequence
GGGGAACCGTCCTATCTCGCAAGGGGACACAAGCAATAGTCCTCTCATGAGATAACAATCCAGCCTGGA
Sequence Type genomic DNA
Unitrap ID UNI30557

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 117086582..117086649 68
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028677 (Rnf220) NM_025739 ring finger protein 220 Gene [Source:MGI Symbol;Acc:MGI:1913993]


Sequence tag IST12266C1BBF1
Sequence
GCTCCATTCCAGCTGGGGTCTTTCTTGCCTTCTTGGGTTCCATTTGTGCCACTGCCTCACCGGTGGCTTTGCCTTTTCCA
CTCCTCCCTGCCTCTCCTACCTCCCCTCTCTCCTCAGGATCACACACACACACACACACACACACACACACACACACACA
CACAN
Sequence Type genomic DNA
Unitrap ID UNI33979

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 79040027..79040190 164
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075555 (AL591921.6-201)  

 
Come back to gene ENSMUSG00000075555


For any suggestions or comments, please send an email to unitrap@crg.es