Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P073B04
Clone ID P073B04
Vector FlipROSACeoC-2
Project ggtc

Sequence tag P073B04
Sequence
TTTTCATCATGGAGCTCTCGCGGCGGATCTGTCTCGTGCGACTGTGGCTGCTGCTCCTATCGTTCTTACTGGGCTTCAGC
GCGGGATCTGCCATCGACTGGCGGGAACCCGAAGGCAAGGAAGTACGGGATTATGTATCGTCCGCNNAGGAGGACCACAT
GTTATGCTGGCTCTATTATACNACCAGACCCTTGCAAGCAATGTCTNNGNATGCTGACCCTCAATCATGCTTCCTCAG
Sequence Type mRNA
Unitrap ID UNI10506

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 88813756..88816691 85
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000278 (Scpep1) NM_029023 serine carboxypeptidase 1 Gene [Source:MGI (curated);Acc:Scpep1-001]

 
Come back to gene ENSMUSG00000000278


For any suggestions or comments, please send an email to unitrap@crg.es