Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14799H10
Clone ID IST14799H10
Vector VICTR76
Project tigm

Sequence tag IST14799H10BBF1
Sequence
GATGAGAATTGGTATTGATTTGGTGAGTCATCACGAGGCTGATGGGGACGCTGTGTTCCTTTCTGTGCTAGAAATCTCCC
TGTCAGGCAGATCCATCATCTGTTGATGCTCAGAATTAGGAAGAAAAAAGAGGAAGGAAGAAAGCTTTCTTCAGCCCAGC
AGGGAGGAAGGATCAGGACAAAGAAGCTGAGCCGCAGAGAAATTGTTACATAGCCAGCCGGAGAGTGATTGATTGCACAG
TAAACAAGAACACAGCCAACCTGTGTCTCCCCCTAAGTCGTAGGGTTGGAGGCAAGAGCTTTCCTCTGCTGGCCNCTAGA
TGGCAGTATTGGCAAGGTCAGCCTGAATGTGATTACCTGGGTTGGCTCTAGTCNNNANGTTCCACGGTTCANNAACAGAA
TACTCAACACATNNGTTTATN
Sequence Type genomic DNA
Unitrap ID UNI29636

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 57288064..57288483 402
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038764 (Ptpn3) NP_035337 protein tyrosine phosphatase, non-receptor type 3 Gene [Source:MGI (curated);Acc:Ptpn3-001]


Sequence tag IST14799H10HMR1
Sequence
NAGGAAGGATCTCTCCAGATGTGACCCCTCAGTCTTGCATCTCTCCGTAACCATGAGACAGCACAGACCATTTGTGTGTG
GACAGGAGTGAGGAGAGGGAGGCACCCGGCGCAGGTAGGGCCTTGTTCCACTGAATGAGGGGAGCTCACACTTGGACCAG
AAGCACATGGTGGTGCAGGCCTCCCCAGAGTCTGTACTAACTCACCTCAAACTTTAGCACTGAGAGTCCCTCAACCTGGA
CAGCTCTTCACTTCCAGCAAACTAGGATGATTACTGTCCTCTCCGGGCTGAGACCANCCGGTAGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 69514422..69514726 303
NO GENE  


Sequence tag IST14799H10HMF1
Sequence
GATGAGAATTGGTATTGATTTGGTGAGTCATCACGAGGCTGATGGGGACGCTGTGTTCCTTTCTGTGCTAGAAATCTCCC
TGTCAGGCAGATCCATCATCTGTTGATGCTCAGAATTAGGAAGAAAAAAGAGGAAGGAAGAAAGCTTTCTTCAGCCCAGC
AGGGAGGAAGGATCAGGACAAAGAAGCTGAGCCGCAGAGAAATTGTTACATAGCCAGCCGGAGAGTGATTGATTGCACAG
TAAACAAGAACACAGCCAACCTGTGTCTCCCCCTAAGTCGTAGGGTTGGAGGCAAGAGCTTTCCTCTGCTGGA
Sequence Type genomic DNA
Unitrap ID UNI29636

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 57288172..57288483 312
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038764 (Ptpn3) NP_035337 protein tyrosine phosphatase, non-receptor type 3 Gene [Source:MGI (curated);Acc:Ptpn3-001]

 
Come back to gene ENSMUSG00000038764


For any suggestions or comments, please send an email to unitrap@crg.es