Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14398A10
Clone ID IST14398A10
Vector VICTR74
Project tigm

Sequence tag IST14398A10BBF1
Sequence
GCTATGGGCACATATGCTTGAAAATGTGCTAGTTCAGCCAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 148233594..148233638 45
NO GENE  


Sequence tag IST14398A10HMR1
Sequence
TAGCTACCCATAACCGCAAGGCCTCTGCCTCTGGGTGCCTAGAGCTCACGCTGTCACTTTGGTGACACAGAGACCTGTGC
TGCCTGCCTGTTGGGTTGCACAGGACCGGTCCTTTGGTNAGTANATGGCCAN
Sequence Type genomic DNA
Unitrap ID UNI20147

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 148233635..148233765 127
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028977 (Casz1) NM_027195 castor homolog 1, zinc finger (Drosophila) Gene [Source:MGI (curated);Acc:Casz1-004]


Sequence tag IST14398A10HMF1
Sequence
GCTATGGGCACATATGCTTGAAAATGTGCTAGTTCAGCCAGATCTTGCCAAGCGACTGGCCTGTATCAATGGCACCCTCT
CCACCACAGGGACCTTCCTTCAGTGGGGGAAGAATTGAAGAGTTAAAGGCAGATCCCAAAGGACACTGTGTCCAGGCCTT
CCTGGGCTAGCCTCTAACCATTACCCAGGACGCATTGGTGCTCTTGACGCCTGGTCCCAACCTGTTGCAGACAGGCAGTA
TCTCCAGCCTTGCTTGGAGCATTGCTGGGCAGGATTCAGCCAGGCTCTGATGCCCGCCCCTATGCCGTCCCCGGCCAGGC
AGATTCACCATAATATCTGGTANCCAAGTGCTCCAGAGTCATTCTCTGTCTCTCACATTCCTGGCCCAATGTCTCAGANT
CTGGATAGCATAGAGGAGGTCACTGAGCTGCTGGTGGCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 148233200..148233638 435
NO GENE  

 
Come back to gene ENSMUSG00000028977


For any suggestions or comments, please send an email to unitrap@crg.es