Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14857C6
Clone ID IST14857C6
Vector VICTR76
Project tigm

Sequence tag IST14857C6HMR1
Sequence
TTTACATGGTGGATCGTGCACGTGTCACAGCGCCTGTGGAGGTCNNAGGANAACTTTACACAAGGTTGTTATTTCTTTGC
ACCACGAGGGGCCTGGGAATCCAACTCAGGGTGTCATGCTTGGCTAAGTGCCCTTACCAGCTGAGCCATTTTTGGAAGTT
TTTTTTTTTTTTTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI8009

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 29903661..29903839 173
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039715 (Wdr34) NP_001008498 WD repeat domain 34 Gene [Source:MGI (curated);Acc:Wdr34-001]


Sequence tag IST14857C6HMF1
Sequence
AATTAACTACATGTCATTTAACGACAGCATGGGACCCCTAAGAGTTCTGTTGTCCTGGTTTGCTTTTGTTGTTGTTTGTT
TTCGTTGGTTGGTTTCTTTCTCCTCANAGACCGAAAAAAAGGCTAACGCGAAAGCATCTGTGAGTTTTTTCATTAAAACA
TGAAAACACGCGGACCANTGGTGGCGCACGCNNTTNNTCCCAACACTTGGGANGCAAAGGCAGGCGGAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 29903838..29904065 210
 
EST/CDNA Est Name
  CF577889.1 - BY005976.1 - CV306916.1


Sequence tag IST14857C6BBF1
Sequence
AATTAACTACATGTCATTTAACGACAGCATGGGACCCCTAAGAGTTCTGTTGTCCTGGTTTGCTTTTGTTGTTGTTTGTT
TTCGTTGGTTGGTTTCTTTCTCCTCNNANACCGAAAAAAAGGCTAACGCNNAAGCATCTGTGAGTTTTTTCATTAAAACA
TGAAAACCCNCGGACCANTGGTGGCGCACGCCTTTCNTCCNANCANNTGNGANGCANANGCNNGCNGATCTCNGANTTCN
AN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene CF577889.1 - BY005976.1 - CV306916.1


For any suggestions or comments, please send an email to unitrap@crg.es