Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P072F09
Clone ID P072F09
Vector FlipROSACeoC-2
Project ggtc

Sequence tag P072F09
Sequence
TGGGCATCAGACCAAAAAGCAACCTCGCAGAATGAAACGGGAAGATCTACACTCTATGAAGTACGTGGAGCTTTACCTGG
TGGCTGATTATGCAGA
Sequence Type mRNA
Unitrap ID UNI11109

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 45926425..45927189 65
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000011256 (Adam19) NM_009616 a disintegrin and metallopeptidase domain 19 (meltrin beta) Gene [Source:MGI (curated);Acc:Adam19-001]

 
Come back to gene ENSMUSG00000011256


For any suggestions or comments, please send an email to unitrap@crg.es