Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14282A3
Clone ID IST14282A3
Vector VICTR74
Project tigm

Sequence tag IST14282A3HMR1
Sequence
CAAGTACACTAGTCCTACTCCACCTCGTCACACGTCATTTCCCCATCAGAGCATGCTTGAGATCATTCTGCTCTCTGGAT
TGAGATTGCCCTTTAGCCTCAGGTACTCACCACCCTGGAGGTTCTCCGCAGGGCAGGGAGGAATAGGAAGGCTTGTCTCG
ACGCCACTCCCTAAAATGGGACTACAGAGTAGTGACAGAGGTTACCACCGAAGTAATAACAGGCTTGGTGGCTTTAAAGC
TANCGTTAGGACGCAAATTTGTTTTGCTCTGTGNANNGTTC
Sequence Type genomic DNA
Unitrap ID UNI15265

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 36052504..36052783 272
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024436 (Mrps18b) NM_025878 mitochondrial ribosomal protein S18B Gene [Source:MGI Symbol;Acc:MGI:1914223]


Sequence tag IST14282A3HMF1
Sequence
CTTGCTTTTAATTCCNTAATCTGGGAGGGAGAGGTAGAAAGCTCANAAAGTACCTATGAGACCAACCTGGGCTGTCTCCC
GAACACCGGGGAAAATCCTTAAAATAGGGTCCTTTGCTAAAAAAAAAACANCNNCANCAAAAAAAANCNNANCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14282A3BBF1
Sequence
CTTGCTTTTAATTCCATAATCTGGGAGGGAGAGGTAGAAAGCTCAGAAAGTACCTATGAGACCAACCTGGGCTGTCTCCC
GAACACCGGGGAAAATCCTTAAAATAGGGTCCTTTGCTAAAAAAAAAACANCANCNNCAAAAAAAANCCNNNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 36052780..36052928 139
 
EST/CDNA Est Name
  AI790097.1 - BU695619.1

 
Come back to gene AI790097.1 - BU695619.1


For any suggestions or comments, please send an email to unitrap@crg.es