Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10351H4
Clone ID IST10351H4
Vector VICTR76
Project tigm

Sequence tag IST10351H4BBF1
Sequence
TTAGGACAGCCTGGTCTGCAAACTGAGTTCCAGGACAGCCAGGGGTATACAGAGAAACCCTGTCTCG
Sequence Type genomic DNA
Unitrap ID UNI32071

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 118765915..118765979 61
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 119810216..119810280 61
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032512 (Wdr48) NM_026236 WD repeat domain 48 Gene [Source:MGI Symbol;Acc:MGI:1914811]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 48249152..48249216 61
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 17224995..17225059 61
NO GENE  

 
Come back to gene ENSMUSG00000032512


For any suggestions or comments, please send an email to unitrap@crg.es