Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10062E2
Clone ID IST10062E2
Vector VICTR75
Project tigm

Sequence tag IST10062E2HMR1
Sequence
TATATTTTTAACAAAGATTACAAGTTTAGTATGACGTATTTTGAGTTAGAATGCAAAGAAAGAAATGCAAGCATATTTTA
TATTAAGGTGTATTGATTGCCTATCATAAAGAATTGTGACATTTGGGGCTTCAGAATGTTATCGAAAGCAATTAGAATTT
GTTGGCTTGTATCTGAAATTACTGTTTTCTTTATCTCTTGAGACTAGGCAGTGTTTGCAATGTGCTTGAGGGATGTTTGT
TTTTTATCTGATACCACAGAGGTTACTTATAAAGTTACTTTGTATAAACTCTCTTTTTCCCCAAGTGACAGCCACAACTG
ATGGNATANNTTTGTTGTN
Sequence Type genomic DNA
Unitrap ID UNI15084

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 12362645..12362982 332
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020173 (Cobl) NM_172496 cordon-bleu Gene [Source:MGI (curated);Acc:Cobl-003]

 
Come back to gene ENSMUSG00000020173


For any suggestions or comments, please send an email to unitrap@crg.es