Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11499H12
Clone ID IST11499H12
Vector VICTR76
Project tigm

Sequence tag IST11499H12HMF1
Sequence
AACTGAGGCTACATTGCAAGTGTTGGGGAAGAGACACAAGACACAGCTAGCTACCCTGTATCCCCGGGGACATGGAGGCT
GAN
Sequence Type genomic DNA
Unitrap ID UNI30541

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 104170588..104170669 82
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018411 (Mapt) NM_001038609 microtubule-associated protein tau Gene [Source:MGI (curated);Acc:Mapt-003]


Sequence tag IST11499H12BBF1
Sequence
AACTGAGGCTACATTGCAAGTGTTGGGGAAGAGACACAAGACACAGCTAGCTACCCTGTATCCCCGGGGACATGGAGGCT
GAGCTAANCAGCAGGTCCACATCTCCCCGAGCCCGATGGCTTTAGGGGGTCCTGANAAGTGGGAGACTGGAGCTGAACGC
TGACGCTTTGAGGGGGATCAGCTGCANTGAGCTTATTTGCTATGGGAGCTTCTTGCTGTGGGCTGGGAAGCTTGANAAAG
ACCAGTTTTGCAAGCCCAGTGCCTCTGTCATATCTGGTTCTATCANATCTGT
Sequence Type genomic DNA
Unitrap ID UNI30541

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 104170588..104170878 281
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018411 (Mapt) NM_001038609 microtubule-associated protein tau Gene [Source:MGI (curated);Acc:Mapt-003]

 
Come back to gene ENSMUSG00000018411


For any suggestions or comments, please send an email to unitrap@crg.es