Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11038E5
Clone ID IST11038E5
Vector VICTR76
Project tigm

Sequence tag IST11038E5HMF1
Sequence
CGGTCTGGGAGACTTTCTTCTCCGTGGCCTAGGATGTTTTTTTATGTTGTTGCCTACTCCCTCCCTCTCCCTCCTCCTTT
CTTCTGTATGTAGTTTTTAAATTGAGGGTCGTGGTTTTTGATTTAATGATTATTTCCAGCTTCTATGCTATGTCTATCAG
AAACTTTTGATCTGTGGGGTTAGGTTTAAGTAAAGGAGACGCTTGTGTTGGTTTGCAATGGTTCCTTAAAATGCGCGGGC
CGCCTCCTCCTCGACCCTGGTAAAACCCCATCTTCCCTTCACATTGGAGTGTAAATTCCGTACCCCCTTTCTCCCACGGA
CCGCCGTATTTCACAGCAGCCACACCCTGTATATATGTCTCTGTGGATTGGACTCATTATCAGCTTAATTTAGTGACTTA
AACNNCCNTGATGGGACTTGCTTAAGCACGAAGCTTCTTTTCCTGTTTGGTCCTGGTGGCTAGTGTCNAAAGANGAATAA
TCGAGGTTTCTTAANGAAACCTAGTGCGGTCCAAGCNTTGCCTTTTTTTCTGTTGNCTTTTTTCCTACNNCGGNCTNNTG
NCGGNNTN

Sequence Type genomic DNA
Unitrap ID UNI18774

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 39504729..39505292 536
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025862 (Stag2) NM_001077712 stromal antigen 2 Gene [Source:MGI (curated);Acc:Stag2-002]

 
Come back to gene ENSMUSG00000025862


For any suggestions or comments, please send an email to unitrap@crg.es