Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14883F7
Clone ID IST14883F7
Vector VICTR76
Project tigm

Sequence tag IST14883F7BBF1
Sequence
CCTGGTCTACATAGAGAGTTCAGGAACAGACAGAGATATACAAAGAACTCCTGTCTCAAAAACAAACAAACAAAAAAACA
AAACAAAAACCAACAACCATAAAAGACTTCAAGGGCCAGCAAGAGCTATATGAAACCTTGCCTCAGAAGCAACAACAGCA
AAAATAACAAGGGCAAAGTTAAATGAAAAGGGAGGACTAGGGGAGGCCACAGCAGACACAGAACCCCCTCCCTCGATTGG
GAGCCAAGACAGAAGAAGCTGGGCTGAAAGCTAGGCAAGGGCTGAAGCCCAGGTAAGGACAAAACCATGAAGGTATTAAT
TACACCTAGGCAGTCCTGAAACAGACAGCTGGAGGTCANAGCAACNCGGCAAAGCCNNGCAGGANNNNAGGANCAGACAA
NANNGTCATGCCNNCAATGGGACTGAGACATCTGGCCTCCTGGGTGGGGACN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 26061250..26061700 423
 
EST/CDNA Est Name
  AA475257.1 - BG864253.1 - BU695397.1


Sequence tag IST14883F7HMR1
Sequence
AGGCTGGACGTAAACTATANATTCCCCTGCCTCTGCCTCTTGAGGGCCTCCAAGCCTGTCCACTTTACACGGTACTGGGA
NTGN
Sequence Type genomic DNA
Unitrap ID UNI5525

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 26061698..26061780 79
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005442 (Cic) NP_082158 capicua homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1918972]


Sequence tag IST14883F7HMF1
Sequence
CCTGGTCTACATAGAGAGTTCAGGAACAGACAGAGATATACAAAGAACTCCTGTCTCAAAAACAAACAAACAAAAAAACA
AAACAAAAACCAACAACCATAAAAGACTTCAAGGGCCAGCAAGAGCTATATGAAACCTTGCCTCAGAAGCAACAACAGCA
AAAATAACAAGGGCAAAGTTAAATGAAAAGGGAGGACTAGGGGAGGCCACAGCAGACACAGAACCCCCTCCCTCGATTGG
GAGCCAAGACAGAAGAAGCTGGGCTGAAAGCTAGGCAAGGGCTGAAGCCCAGGTAAGGACAAAACCATGAAGGTATTAAT
TACACCTAGGCAGTCCTGAAACAGACAGCTGGAGGTCAGAGCAACACGGCAAAGCCATGCAGGAAACTAGGANCAGACAA
GAAGGTCATGCCNGCNATGGGACTGAGACATCTGGCCTCCTGGGTGGGGACTCCNNTTGGTACTGGANGGGTGTNCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 26061223..26061700 460
 
EST/CDNA Est Name
  AA475257.1 - BG864253.1 - BU695397.1

 
Come back to gene AA475257.1 - BG864253.1 - BU695397.1


For any suggestions or comments, please send an email to unitrap@crg.es