Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12888H8
Clone ID IST12888H8
Vector VICTR76
Project tigm

Sequence tag IST12888H8BBF1
Sequence
TTTGTTCATGTGCCCATTGAGCAATGACAGGGATGGCTGGGGAGAGAGGCTGATTGTCCACAGAACGGGTCATCTTATCC
ACTTGATTATTGAACTCCTCCTCAGCTGAAGTCACCTTTTGGTGAGCATTTACATGGGACACAAATATCTTCACATCCTT
TGCCCATTTGGAGAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI9273 UNI30944 UNI30945

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166437: 32763..32941 179
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166435: 90546..90724 179
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 17094193..17094371 179
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000054366 (Prune2) prune homolog 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1925004]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 4659907..4660085 179
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033960 (9430020K01Rik) NM_001081963 RIKEN cDNA 9430020K01 gene Gene [Source:MGI Symbol;Acc:MGI:2685174]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 17414923..17415101 179
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 14571725..14571903 179
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 16880397..16880575 179
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 10175883..10176061 179
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 9512205..9512383 179
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 22297283..22297461 179
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 20425489..20425667 179
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 43782739..43782917 179
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 25344639..25344817 179
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 7261827..7262005 179
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 11072278..11072456 179
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 18227813..18227991 179
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 32978630..32978808 179
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000014932 (Yes1) NM_009535 Yamaguchi sarcoma viral (v-yes) oncogene homolog 1 Gene [Source:MGI Symbol;Acc:MGI:99147]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 39596362..39596540 179
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 35326731..35326909 179
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 4739402..4739580 179
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 3851867..3852045 179
 
EST/CDNA Est Name
  AI930322.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 29701968..29702146 179
NO GENE  


Sequence tag IST12888H8HMF1
Sequence
TTTGTTNATGTGCCCATTGAGCAATGACAGGGATGGCTGGGGANANAGGCTGATTGTCCACAGAACGGGTCATCTTATCC
ACTTGATTATTGAACTCCTCCTCAGCTGAAGTCACCTTTTGGTGAGCATTTACATGGGACACAAATATCTTCACATCCTT
TGCCCATTTGGAGAGATCTATCCACATACTTCTTCCCCAGATGTCTTTCTCACCAATTTTCCAATTGTGATCTTTCCAAG
TCCCTGACCATCCAGCCNATCCACTGGCTACAGCCCATGAGTCANNNNNNNATCGTACATCTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 11337682..11337985 282
NO GENE  

 
Come back to gene AI930322.1


For any suggestions or comments, please send an email to unitrap@crg.es