Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14309B4
Clone ID IST14309B4
Vector VICTR74
Project tigm

Sequence tag IST14309B4HMF1
Sequence
GAGGCCAGCCTGGTCTACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGAAACCCTGTCTCAGA
Sequence Type genomic DNA
Unitrap ID UNI1328 UNI13375 UNI30852 UNI32074 UNI32075 UNI32076

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 5805804..5805871 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 41503345..41503412 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 28856139..28856206 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 4450920..4450987 68
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049148 (Plcxd3) NM_177355 phosphatidylinositol-specific phospholipase C, X domain containing 3 Gene [Source:MGI (curated);Acc:Plcxd3-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 55735234..55735301 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 3599119..3599186 68
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000071454 (Dtnb) NM_007886 dystrobrevin, beta Gene [Source:MGI Symbol;Acc:MGI:1203728]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 45378306..45378373 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 40527229..40527296 68
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032024 (9030425E11Rik) NM_133733 RIKEN cDNA 9030425E11 gene Gene [Source:MGI Symbol;Acc:MGI:1918816]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 45975136..45975203 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 8703077..8703144 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 10010788..10010855 68
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031497 (Tnfsf13b) NM_033622 tumor necrosis factor (ligand) superfamily, member 13b Gene [Source:MGI Symbol;Acc:MGI:1344376]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 122594982..122595049 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3536751..3536818 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 20438283..20438350 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 6468034..6468101 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 82856998..82857065 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7472584..7472651 68
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031157 (Pqbp1) NM_019478 polyglutamine binding protein 1 Gene [Source:MGI (curated);Acc:Pqbp1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 25326421..25326488 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 37865338..37865405 68
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060771 (Tsga10) NM_207228 testis specific 10 Gene [Source:MGI (curated);Acc:Tsga10-001]

 
Come back to gene ENSMUSG00000060771


For any suggestions or comments, please send an email to unitrap@crg.es