Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14511H6
Clone ID IST14511H6
Vector VICTR74
Project tigm

Sequence tag IST14511H6HMR1
Sequence
TACNNCCCATGTTGGGAACATACAAGTACCTGTAGCTCCAGCTCCCTGGGACCCGACAGCCTTTCCTGGCCTCCTTGAAC
ACTCACACTCACCTGTGCACAGGACACCCCCCCCCCCAA
Sequence Type genomic DNA
Unitrap ID UNI31250

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 130657491..130657608 114
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025340 (Rabgef1) NM_019983 RAB guanine nucleotide exchange factor (GEF) 1 Gene [Source:MGI (curated);Acc:Rabgef1-001]


Sequence tag IST14511H6BBF1
Sequence
GGTAGATGTTCTCTGTAACAGCAGTACATGCTCTTAACTACTGAGCCAGTTCTTTAGCACCTGATTAACAATTTTTACTA
ATGTAACCACTGATATTTTCTGCTCCTGTGTCTATATCTCTAAAATTTCCCTTTGATTCCCAGGTCCTCTTTTTTAATTA
TCCTGTTTGCTTGGTTTTTTGTTTTGGGTTTTTTTTTTTTTTTTTTTTTTTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 130657284..130657494 211
 
EST/CDNA Est Name
  AV131687.1


Sequence tag IST14511H6HMF1
Sequence
GGTAGATGTTCTCTGTAACAGCAGTACATGCTCTTAACTACTGAGCCAGTTCTTTAGCACCTGATTAACAATTTTTACTA
ATGTAACCACTGATATTTTCTGCTCCTGTGTCTATATCTCTAAAATTTCCCTTTGATTCCCAGGTCCTCTTTTTTAATTA
TCCTGTTTGCTTGGTTTTTTGTTTTGGGTTTTTTTTTTTTTTTTTTTTTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 130657285..130657494 210
 
EST/CDNA Est Name
  AV131687.1

 
Come back to gene AV131687.1


For any suggestions or comments, please send an email to unitrap@crg.es