Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10123H5
Clone ID IST10123H5
Vector VICTR76
Project tigm

Sequence tag IST10123H5BBR1
Sequence
TTGGGTTCTTCTTTTTCCCACCCTTTATTTCCTAAGTTTCACTCCCTAACAATCGATAGGAGGGAAGGAAGGAAGGGGGT
CCGGAAGAGAGAGAGATG
Sequence Type genomic DNA
Unitrap ID UNI7146

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 56873380..56873475 90
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038816 (Ctnnal1) NM_018761 catenin (cadherin associated protein), alpha-like 1 Gene [Source:MGI (curated);Acc:Ctnnal1-001]


Sequence tag IST10123H5HMF1
Sequence
CCACAAAGTAGCAAAGGGAAGCAACAGAACAGACTTGCAGCTATGGCTCAGTCATTTTAATCATACATAGACTCTTTGGG
GCTAAACATTCCACAATTAATTTAAACATCCTGTTAAAAGATTTTGGTAGTTTTTCATTTGGGAACTTCACAAGTAAAAT
GTTATTCATACTCGGATTCTATGTA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 56873473..56873656 184
 
EST/CDNA Est Name
  CJ071032.1

 
Come back to gene CJ071032.1


For any suggestions or comments, please send an email to unitrap@crg.es