Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14957C11
Clone ID IST14957C11
Vector VICTR76
Project tigm

Sequence tag IST14957C11HMR1
Sequence
CCCTGGTCCTGATACCACTGAGGGAGATGGAATTGATCTCCCAGGCTCTTTGCTTGCCCATTCCCTTCATCCCGTTGGAA
TGAACACCCTCGAGTCTGCTCTGTTACCTCCTCCCGTCCCCCTTAGCACCAGCCAGTGGCTCCCCATTGTTTATCANCTT
TGCTTAAGCCCCTGGGGGTGCGACTGCAGACTTTCTGTATCCTGGCCCCACTTACCCCTACACACTGCCTCCCTCGGACT
TCANCCCTACTGCTCTGTGTACTGGCCN
Sequence Type genomic DNA
Unitrap ID UNI23116

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 29992533..29992799 263
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000043557 (Mdga1) NM_001081160 MAM domain containing glycosylphosphatidylinositol anchor 1 Gene [Source:MGI Symbol;Acc:MGI:1922012]


Sequence tag IST14957C11BBF1
Sequence
CAGGGAAAGGGCTGAGGCTCTGAGCTAGGTGGGCCTATGGAGAGGAGACCACACAGAAAGCCAGAGTCTGGCCAGCCAGC
TATGGGGGAAATGGGGGCAGAGCCAAAAATGTAAGCTTGTTTGACAGGGTGAACAATGAAGCCNGTGATGGAAACAGGAA
NACNNAGGGTGCTTACCCNNNANNCCTANCATGAACCANACCTGGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14957C11HMF1
Sequence
CAGGGAAAGGGCTGAGGCTCTGAGCTAGGTGGGCCTATGGAGAGGAGACCACACAGAAAGCCAGAGTCTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 29992795..29992865 71
NO GENE  

 
Come back to gene ENSMUSG00000043557


For any suggestions or comments, please send an email to unitrap@crg.es