Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14181A7
Clone ID IST14181A7
Vector VICTR74
Project tigm

Sequence tag IST14181A7HMR1
Sequence
ACTCCNGAAGCTGAGCAGCCNTGACATTTGCTGAGGACAAGACCTATAAGTATATCCGAGACAACCACAGCAAGTTTTGC
TGTGTTC
Sequence Type genomic DNA
Unitrap ID UNI32085

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 131064510..131064595 82
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037523 (D430028G21Rik) NM_144888 RIKEN cDNA D430028G21 gene Gene [Source:MGI Symbol;Acc:MGI:2444773]


Sequence tag IST14181A7BBF1
Sequence
ATTCCAGTTCCGGAACCCCATCTTCGGCCTCCCCAGCTTTGTCCCGCCGAGGCAGCCTTGGGGAAGAAGGTCCAGAGCCA
CCTCCACCACCCCCGTTGCCTCTGGTCCGGGACCCTAGTTCCCCTGGCCCTTTTGACTATGTGGGTGCTCCACCAACCGA
GAGCATCCCTCAAAAAACTCGGAGGACTTCTANCGAGCAAGCAGTGGCCCTGCCTCGGTCTGAAGAGCCTCCCTCGTGCA
ATGGGAAGCTACCCTCCGGTACAGAGGACTCTGTGGCTGCTCCGGGGGCTCTGCGGAAAGAGGTGGCCGGCATGGATTAC
CTANCAGTGCCTTCTCCCCTTGCTTGGTCCANGGCCNGGAN
Sequence Type genomic DNA
Unitrap ID UNI32105

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 56445706..56446065 350
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023411 (Nfatc4) NM_023699 nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 4 Gene [Source:MGI Symbol;Acc:MGI:1920431]

 
Come back to gene ENSMUSG00000023411


For any suggestions or comments, please send an email to unitrap@crg.es