Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10085B11
Clone ID IST10085B11
Vector VICTR75
Project tigm

Sequence tag IST10085B11BBR1
Sequence
AAAGAGACGCCTTGTGGGATTGATGAAAATCCCAGTTTAGAGCATTTTACCCCTTTTGTGGCATCTAATCTTTCTCTTTC
ATTACCACTTAAGCCACACGCGGTGAGAATCCCTTCACTCTGGTCACACTGGTTTGCCTAGCACCCTCCCGCACTGCACT
TAGCATTTCCCAAACCCAGAAACAGTAGCAGGCAAGAATGCTCTAGCCCTTTAATGTAGCATGCTGGAAAGCAGGCGATG
CGGCTGGA
Sequence Type genomic DNA
Unitrap ID UNI13061

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 84855298..84855544 247
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000073633 (Fbxo36) NM_025386 F-box protein 36 Gene [Source:MGI (curated);Acc:Fbxo36-001]


Sequence tag IST10085B11BBF1
Sequence
CTTTAATAAAAAAGTCGGGATCATTTATTATTATATTAAATTATTATTATTAAAGGGATTAAAGGTGGTCCAGGACAACC
AGGGCTATATAGAGAAACCAACCTTGCCTTGAAAAATCCAAATAAAAACAAAAATATACACTCACCAAAAAAGGCTATGG
TTGGGAGGGGTTGAGAGATGGTTTAGGGCTCAGAGTGCTTGCTGGGGCCCACTAAGATGGCTCATCAGGCCGGGCGTGGT
GGCGCACGCCTTTAATCCCAGCACTCGGGAGGCAGAGGCAGGCGGATTTCTGAGTTCGAGGCCACGTTGGTCTCCAGAGT
GAGTTCCAGGACAGCCAGGGCTACACAGAGAAACCCTGTCTCGAAAACCAAAAAAAAAAAAAAAAAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 84854916..84855301 386
NO GENE  

 
Come back to gene ENSMUSG00000073633


For any suggestions or comments, please send an email to unitrap@crg.es