Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14742D1
Clone ID IST14742D1
Vector VICTR76
Project tigm

Sequence tag IST14742D1HMR1
Sequence
GAATATATAGGTAATTTGCACTAAGGAAATACAACTAAGCCGACTTGTGTTTTTCTTTAGAATGGCACAACCCCGCTTTC
CTGGCACGTTCGAATCANCGTATTGATAGGAATAGCCAAAGCCATCCAATACTTGCACAACACTCAGCCGTGCGCCGTCA
TCTGTGGCAACGTTTCCAGGTAAATGACCTGAGAGCTCTGGGTTCCACCTAAATCCCTGTCAGCCCTGCAGGTGAGTGTT
CTTTTCGGCCAGGCCTCTTCCTANAATACTTAGGAGTGCAATAAACCCTCTCACCTACNTANNGAANNTCTCACTTTTTT
TTTTTNNCN
Sequence Type genomic DNA
Unitrap ID UNI32086

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 119602003..119602327 311
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020227 (Irak3) NM_028679 interleukin-1 receptor-associated kinase 3 Gene [Source:MGI Symbol;Acc:MGI:1921164]


Sequence tag IST14742D1BBF1
Sequence
NNNNNNANGCNNGCNTATGGTTCTGTANCCACTGTGGGCATTTTGTCTAGGCTCCGCCCCACAGTTGCCTGGCAACAGCC
AAATGTGCCTTACTATAAAAGGGGCTGCTTGCCCCCTCTCACTCTTGTTCTCTTCTCCTCTTGCTCTTT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 119602337..119602472 132
NO GENE  


Sequence tag IST14742D1HMF1
Sequence
ATTCCCTATGCAGGCATATGGTTCTGTAGCCACTGTGGGCATTTTGTCTAGGCTCCGCCCCACAGTTGCCTGGCAACAGC
CAAATGTGCCTTACTATAAAAGGGGCTGCTTGCCCCCTCTCACTCTTGTTCTCTTCNNNNCTTGCTCTTGCCCCNTACCC
TCTCCCCACCCCATTCCCCTTCTCATTCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 119602324..119602511 178
NO GENE  

 
Come back to gene ENSMUSG00000020227


For any suggestions or comments, please send an email to unitrap@crg.es