Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13778G5
Clone ID IST13778G5
Vector VICTR74
Project tigm

Sequence tag IST13778G5BBF1
Sequence
CAGGGACCGCTTCCTGAGACCCTCTATATAGGGCCCTGTAGCTGGCCAGGAAGCCAGACTCTGGCATTTTGTAAAAAGTG
CTGCAGTTGAGGCCGGCAGAAAACTGAACGGCGGGAGCTAGCCAAGGCAAGGCCTTCAGTGCCAACCGCGAGTCTACTGT
AAGTGCCAGGTTTTGATGGGTTTTACCCTTGCTCAACCGCGGATTACAGCACCTTTTGAATTACTGGTGTTATGCCATTC
AATAGAGGTTCATCAAATATCCAGTGTTCATCTCCAGTTTGGAAGCGACATTTATAAGCAAATTGATGTTCGTAAGAGGG
TGGAGGGTATGCAATATGTTACTTTAATCAACTGCTCTAANGACAGTTGCTGGGAAGCCTGTNNAAGANANTGGNCTCTA
AATCCNACTTCTTGATAAAGANANNTCGTGAAATTACTTTTTCCAAAANAAGAANAGTTGTANTGGTACTGANNCGTNNC
NNACNNTGANNNANNGGN
Sequence Type genomic DNA
Unitrap ID UNI18574

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 37297888..37298364 447
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000050714 (Zbtb26) NM_199025 zinc finger and BTB domain containing 26 Gene [Source:MGI (curated);Acc:Zbtb26-001]

 
Come back to gene ENSMUSG00000050714


For any suggestions or comments, please send an email to unitrap@crg.es