Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10629D12
Clone ID IST10629D12
Vector VICTR76
Project tigm

Sequence tag IST10629D12HMF1
Sequence
CAGGGACGCTTGCACCTGGATTTTGGGGTGCTGGGAATAGAATCAGGGCTTCATGCATGTTANGTATGTACTCTGTTAAC
G
Sequence Type genomic DNA
Unitrap ID UNI31376

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 3459700..3459779 78
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023800 (Tiam2) NM_011878 T-cell lymphoma invasion and metastasis 2 Gene [Source:MGI Symbol;Acc:MGI:1344338]


Sequence tag IST10629D12BBF1
Sequence
CAGGGACGCTTGCACCTGGATTTTGGGGTGCTGGGAATAGAATCAGGGCTTCATGCATGTTAGGTATGTACTCTGTTAAC
TGAGCCACATCTTTAACCTTCTGTCTTCTGTTCTGCATTGTCTTGGTTATGGCAGAAAAATGGTCAGTATTANATATCCN
TTCTCTAAATTAGCTGAATTATGAATATGGGGGGAGGGATTCTGTGGTTAAGGTTCTTCAAATAAGGAAAGACTCCTGCG
TANCCCCACTGGTGTCACAANGNCTGACTGTCTTANGGAGGCANANNANTCTGANTCGGAGAATAATGTAATGTGGCGCC
ATGAGCCNAGGACTGCTTGANCCGTCTAACAGGGACCGGANGAATANATTCTGTGTCTCCNGGGGGAGCTCACTTTACTC
TCTGATGGANGTCTNATCTNNNNCTGTATGAGAGAGTCNGTTTGTTNTTATGTGACATGCCCTGGGTTNAATGGCAGTCA
TACNAAGTTTAACATACAGTCCTACTTTTGTGATTCTGTGGTGGGANATGATGTGGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000023800


For any suggestions or comments, please send an email to unitrap@crg.es