Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11252C9
Clone ID IST11252C9
Vector VICTR76
Project tigm

Sequence tag IST11252C9HMF1
Sequence
CTTAGATGAGAAGAGCTAGTTAAGGAGGAAACAGTTAACG
Sequence Type genomic DNA
Unitrap ID UNI11185

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 88811375..88811413 39
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000278 (Scpep1) NM_029023 serine carboxypeptidase 1 Gene [Source:MGI (curated);Acc:Scpep1-001]


Sequence tag IST11252C9BBF1
Sequence
CTTAGATGAGAANAGCTAGTTAANGAGGAAACANTTAACCTANATGAGAAGAGCTAGTTAGCAGCCTTCCAAGGACTTAG
GCAGAAACTTCTTTGCAAAGCGGCTCATCTTTGAGAATGGAGGTCACGTGAATAGCGAGTGANCCATTTNATGGATAGGA
AGCTATTTTTCAAGTCATTTCAGCTTACTCNNTGACACATTTATCTNANNGGAACCGANNANCCCTGAGCCTCAGCTCCC
CATACCANTTNNNNNNAGGGTTNNTGGGTGAAGATTTTTGTGATCTGTTCATTATTATTGTTATTATCATCCTTATATTT
AAATAAGGGCATAAGATANGGCTCAGTTTGNAAAGTGCTTGCTATGCATCTATGCGGATTTGAACTTNNACACCTATACT
TGTCANGATGATCCCTGGAGCTNCCTGGCCTGCCNNNTAGCANANTTCGTGAACTCCANGCTCATCGATAGACCCTGNCT
NNNAAAATAANGTGNNNANCGATTGAGACAGNNNTCTNATGTGNNCTNTGGCTTCCNCNTGTGCNNGTGCNCNTACNCNC
ACGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000000278


For any suggestions or comments, please send an email to unitrap@crg.es