Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P024D02
Clone ID P024D02
Vector rFlpROSAbetageo
Project ggtc

Sequence tag P024D02
Sequence
CTCTCAGGNNNCTCCTCTGCTCCGCCGCCGGGCGAAGTGCTGGGAGACCCAGCCGCCTGTCGCGCTCCTGCAGGGGGACC
CTCAGCTAGGCAGCCAGCTGGCGCCCGCGTAGATGGCGAGGAGCCCCCAAGGCCTCCTGATGCTGCTGCTGCTACACTAC
TTGATCGTCGCCCTGGA
Sequence Type mRNA
Unitrap ID UNI243

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 84774620..84774796 171
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053062 (Jam2) NM_023844 junction adhesion molecule 2 Gene [Source:MGI (curated);Acc:Jam2-001]

 
Come back to gene ENSMUSG00000053062


For any suggestions or comments, please send an email to unitrap@crg.es