Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10091H11
Clone ID IST10091H11
Vector VICTR75
Project tigm

Sequence tag IST10091H11BBR1
Sequence
TTGTTGTTGTTGTTGTTGTTGTTGTTTGATTGAGGCTTCCCTGCTTCCAGAGTCACGCCTCTTCAACCCTAAGTCCAGCC
AGTAGTCACTGGATCCG
Sequence Type genomic DNA
Unitrap ID UNI30861

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 33018441..33018536 96
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040183 (Ankrd6) NM_001012450 ankyrin repeat domain 6 Gene [Source:MGI (curated);Acc:Ankrd6-002]


Sequence tag IST10091H11BBF2
Sequence
AACAAACTAACCGGGAATCTAACAATTTCCACTGGAGGGATGGCTCAGTGGTTAAAAGCACTGACTGTTCTTCCAATTCC
CACCACCCATAGGGTGGCTCACCACTGTTTGTAACTCCAGCTCCAGGGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST10091H11HMF1
Sequence
CAACAAACTCAACCAAACAATCAAACAAAAACCACTGGAGGGATGGCTCANTGGTTAAAAGCACTGACTGTTCTTCCAAT
TCCCACCACCCATAGGGTGGCTCACCACTGTTTGTAACTCCAGCTCCAGGGGATCCAAGGCCCTCTTTGGGTCTCTGTGG
ACACCATCCGTACAAGTGGTGCATACATGTACACATTAATTTGAGGGGGGACTGGAGATACATGCATATATTAATTTGGG
GGGACTAGAAAGATGGCTCANANGCTGANTACTGGCTCTCTCCCANANCACCAGCGCTTGGTTCCCANAACGCACTTCAG
GCAGCTCACCGCCATCTGTAATTCCAGCTCCTGGGATCTGATGCCTTTGGCCTCTAANAGCACCTGCATTCTTGTGCANA
TACCCACGTGCAGATACCCACGTCCATACACAGTTCGAAATAATAACNAATCATTTTTTTTTAAAAATATGACCCANATA
ANGGCCAAGTTGNNAATCAAAANGCTGGCAGTAAACAAGACTGNGCTGNCNAANTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 33018534..33019069 498
 
EST/CDNA Est Name
  CF533090.1 - BY719028.1 - BY320686.1

 
Come back to gene CF533090.1 - BY719028.1 - BY320686.1


For any suggestions or comments, please send an email to unitrap@crg.es