Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10921H11
Clone ID IST10921H11
Vector VICTR76
Project tigm

Sequence tag IST10921H11BBF1
Sequence
NATCCACTGGCCTTAAAAGTCTGTAAACTANGGCGGGGCCAAACAGGTCTTGCTGAGTCACACCGATACAGAAGTGACTG
AGACGGGTCTCAGAACTCGAGCCAGGCTCGGATTTGTCCTCAAGGCCCAAAACAGAGCCNAAATGGGGCCCAACATTTAC
CTGCTTGTGGTGGCACAAGCCTTTAACCCTACTGGGAGGCAGAGGCAGGTGGATCTTTATGGGTCTGAGGCCAGCTTGGT
CTTCATAACNNGCTCCANACCAGCAAGGCCAANGAAGAAACCCCGTGTCAAAAACAAACAAACAAGCACAAGCAATAAAT
AGATCTG

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 84887015..84887338 311
NO GENE  


Sequence tag IST10921H11HMF1
Sequence
NATCCACTGGCCTTAAAAGTCTGTAAACTANGCGGGGCCAAACAGGTCTTGCTGAGTCACACCGATACAGAAGTGACTGA
GACGGGTCTCAGAACTCGAGCCAGGCTCGGATTTGTCCTCAAGGCCCAAAACAGAGCCAAAATGGGGCCCAACATTTACC
TGCTTGTGGTGGCACAAGCCTTTAACCCTACTGGGAGGCAGAGGCAGGTGGATCTTTATGGGTCTGAGGCCNGCTTGGTC
TTCATAACNNGCTCCAGACCAGCAAGGCCAAAGAANAAACCCCGTGTCAAAAACAAACAAACAAGCACAANCAATAAATA
NATCTTTTTTTAAAATTAGGTATAGGAGAAGTGCANGCCTCTANCTTTGCTGTCCATAAATACCCCAGCNNNTNNGAGTG
GCAGAAAGATAAGGGGGAGGGGANCTGCGANACAAAAGCCACCTGGA

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 84886894..84887338 413
NO GENE  


Sequence tag IST10921H11HMR1
Sequence
GTCAAGGANAATTCCCGGAAAGAAGCCATGTAGACCTAAAGGAACTGACTGCTCAGAACTGCACTGAGAGGTTGGAATGT
TGCAGGTCCAGGCCAATTAACAGATAAAACTGTTTTTGGATCTATCAATTANCAGACCTAGCCCATCAGCCCAAAAGCTA
ACTAAGAATGCCATTAACATCCGAGGCCTCTTTTGCTGTAACCACTTCTGATGTACCTATCAGTGTATTTTAAACTTGCC
TTTGTAACAGCGCCNCGGANTTGTTAANCCCCTANACCTTANCNNGACTGACTCNNNGNNGGAN
Sequence Type genomic DNA
Unitrap ID UNI13863

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 84887375..84887668 276
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000073633 (Fbxo36) NM_025386 F-box protein 36 Gene [Source:MGI (curated);Acc:Fbxo36-001]

 
Come back to gene ENSMUSG00000073633


For any suggestions or comments, please send an email to unitrap@crg.es