Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13111H11
Clone ID IST13111H11
Vector VICTR76
Project tigm

Sequence tag IST13111H11BBF1
Sequence
ATGACCATTCCAAAAGGGAGAAAAGGGAGTGTGGTGAGGAAATGCTGAACCAAAAAACACCAAAACCCAGAAAGGAAAAC
TCCTTACTCTGATGTCAAAGGGCTCGGGTGGCTCTCTGGAGGTCCACTCCGCCTTGTGACGTTCTCTCTCCCTTGGGCTG
GCTCCGTGCCCGGTGTGCAGTGCTTCTCAGTGCCTGCACCCACTGCGCCCGCACCTCCATCATCTCAGCTCTCCAATACA
ACCCAGGCAACTTCCACACACTGCAGTAATCTCTCCTCGTCCACGGTGGATGCTACCGAGTCCTGCTGCCTCCTGGATGG
AGACTGTCCAGTGCCAAGACCTGCAATCACAGGAGCTTTGACTTATTCCTGTTTCCCTTTGTTGTGTAAACCCTCCTTGA
ATTCCTTANGCATTTTCCTGTCNNGGGTTCCAGGATTCANCNNNNGCTTTCCTTTCANCTTCTCTTGTCTTGGANCACAG
AACTTGTGCTCANCATGACATTTCCTGGTGCTCCTCTTGTATTTCNCTCTGCTGNGCTTGCGCTTTTAAAA
Sequence Type genomic DNA
Unitrap ID UNI32092

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 57005540..57006090 521
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024207 (Acsbg2) NM_001039114 acyl-CoA synthetase bubblegum family member 2 Gene [Source:MGI (curated);Acc:Acsbg2-001]


Sequence tag IST13111H11HMF1
Sequence
ATGACCATTCCAAAAGGGAGAAAAGGGAGTGTGGTGAGGAAATGCTGAACCAAAAAACACCAAAACCCAGAAAGGAAAAC
TCCTTACTCTGATGTCAAAGGGCTCGGGTGGCTCTCTGGAGGTCCACTCCGCCTTGTGACGTTCTCTCTCCCTTGGGCTG
GCTCCGTGCCCGGTGTGCAGTGCTTCTCAGTGCCTGCACCCACTGCGCCCGCACCTCCATCATCTCAGCTCTCCAATACA
ACCCAGGCAACTTCCACACACTGCAGTAATCTCTCCTCGTCCACGGTGGATGCTACCGAGTCCTGCTGCCTCCTGGATGG
AGACTGTCCAGTGCCAAGACCTGCAATCACAGGAGCTTTGACTTATTCCTGTTTCCCTTTGTTGTGTAAACCCTCCTTGA
ATTCCTTAGGCATTTTCCTGTNNNGGGTTCCNGGATTCANCNNNANGCTTTCCTTTNAGCNNNNNNTGTCTTGNNNCACA
GANNNTGTGCTCANCATGACATTTCCTGGTGCTCCTCTTGNATTTCNCTCTGCTNTGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000024207


For any suggestions or comments, please send an email to unitrap@crg.es