Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P024C11
Clone ID P024C11
Vector rFlpROSAbetageo
Project ggtc

Sequence tag P024C11
Sequence
AGCACGAGCTAACCACGGCGGCCCCGTGGGCAGCCTCGGTGGCCGACAGT
Sequence Type mRNA
Unitrap ID UNI10501

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 51196311..51196359 47
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021395 (Spin1) NM_146043 spindlin 1 Gene [Source:MGI Symbol;Acc:MGI:109242]

 
Come back to gene ENSMUSG00000021395


For any suggestions or comments, please send an email to unitrap@crg.es