Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14707G10
Clone ID IST14707G10
Vector VICTR76
Project tigm

Sequence tag IST14707G10HMF1
Sequence
GTCTCAAAACAAGGAAACAAACAAAGCAAACAAACCAGGGATAAATAAATAAATGGGGTGGGCGTGTCTACTGAGAACAG
ATGGCTGACCTCTGGATTCCACACCACCATGCATACGCATGTGTGCACACACGCACACTCAAAAATAAACAATTTACAAA
ACTATGATTTAAATTTGCTGAAATACACCAATTTGAACAACAAACTTCAAAAAAGAAGGAAAGAAACAGCAATTCATCCA
CATCTGAGGGTCTCAGCTGTGACCTCAGCCTCGGGGAATCAGAGGCTGGAGGATTAGGAGTCCAAGGTCAGCCTGGGCTA
CGTGATAAGATCCTTTTTCCTGTTTGTTTCTAAAGTCATTTAGCTCANNNNGAAACACATTCNAGANACCAAACATNTCC
ATCACCNCAGTGTGGTCCAGCTCCCCCATTAACCTCACCAAGCCCACACNCTGGTCNACTCNGTGCAGCTGCNNAN
Sequence Type genomic DNA
Unitrap ID UNI31455

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 91983766..91984237 450
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000058318 (Phf21a) NM_138755 PHD finger protein 21A Gene [Source:MGI (curated);Acc:Phf21a-002]


Sequence tag IST14707G10HMR1
Sequence
NANNCAGGGTCTTTCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT
CTCTCTCTCTCTTTCTTTCGTTTTTTTGTTTTTTAANACANGGTTTCTCTGAACAGTCCTGGCTTTCCTGGAACTCATTC
TGTANACCAGGCTGCTCTTGAACTCANANATCCNCCTGCCTCTGCCTCCCAAATGCTGGGATAACAGGCGTGTTCCACCA
CTGCCCGGCGACNGGNTCTTTTATTGAGCCTGAGGTTCTGANATTANGTGAGGCTAATGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 91983471..91983766 276
NO GENE  

 
Come back to gene ENSMUSG00000058318


For any suggestions or comments, please send an email to unitrap@crg.es