Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P023E06
Clone ID P023E06
Vector rFlpROSAbetageo
Project ggtc

Sequence tag P023E06
Sequence
GGGCGCGGCGGTGCAGCCCCGGAGCGAGCTTAGGACAGGCGCCACTGCCGCAGGAGGCGCGAG
Sequence Type mRNA
Unitrap ID UNI10816

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 150734947..150735004 58
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000059119 (Nap1l4) NM_008672 nucleosome assembly protein 1-like 4 Gene [Source:MGI Symbol;Acc:MGI:1316687]

 
Come back to gene ENSMUSG00000059119


For any suggestions or comments, please send an email to unitrap@crg.es