Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14337A10
Clone ID IST14337A10
Vector VICTR74
Project tigm

Sequence tag IST14337A10HMR1
Sequence
TTTTATACATGCTAAGTCTTTAGATNATTTTAGTAGTAGTTTTGCTTTAAGAAATTTTATTTCTATTTTTNAAACTTATT
TATTCATATTACGTTTTGAGCCTTTTGTAGCCAAGGAAGATCTTGAACTGTCCATCCTTCTTTCTTTACCNCTAGGTTTT
GGGGATACAGGCGGATGCCACCAAATCCATTTCTGTGGTATTGGGACTTGAACCCAGGGCTTCATGCATCCNANGCCTGT
ATTCNGTN
Sequence Type genomic DNA
Unitrap ID UNI2859

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 55001672..55001918 235
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060206 (Zfp462) NM_172867 zinc finger protein 462 Gene [Source:MGI (curated);Acc:Zfp462-001]


Sequence tag IST14337A10BBF1
Sequence
NAAGCCCTGGGTTCAAGTCCCAATACCACAGAAATGGATTTGGTGGCATCCGCCTGTATCCCCAAAACCTAGTGGTAAAG
AAAGAAGGATGGACAGTTCAAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 55001789..55001893 105
NO GENE  

 
Come back to gene ENSMUSG00000060206


For any suggestions or comments, please send an email to unitrap@crg.es